Мой герой академических сезон 3 эпизод 13

Итак, вам нужно открыть iTunes на компьютере и так чтобы потом в iTunes Store скачать приложение через iTunes магазине. Подключите ваш iPhone/iPad и синхронизировать его. Затем отсоедините устройство от компьютера. Перейдите в App Store на iPhone и загрузить приложение снова и на этот раз.

Я не знаю, почему это работает, но это работает для меня, поэтому стоит попробовать. Просто играть вокруг с этим :)

+997
Jurgo 21 дек. 2012 г., 11:35:23
22 ответов

Вы, вероятно, ищет что-то вроде Gnome2. Есть два разных средах — циннамон и Мате. В (мета)пакет для корицы будет корица-десктоп-среде и (мета)пакет для мат будет матом-десктоп-среде. Так, например, чтобы установить полный корицей рабочего стола, вы могли бы сделать команду sudo apt-получить установку корица-десктоп-среде (или искать и устанавливать этот пакет через Синаптик).

После того как вы установите либо один (или оба!), вы должны быть в состоянии выбрать тот, который должен открываться при входе в систему. Нет ничего плохого в установке, так как вы можете выбрать, какой вы хотите (и одна по умолчанию, если вы хотите) когда вы входите в систему.

+969
jakir hussain 03 февр. '09 в 4:24

тип -а-п обеспечивает эту функциональность.

поручает его обеспечить всем, а не только первый.

говорит, что печати только (в противном случае вы получите <исполняемый файл> является префиксом путь) и игнорировать нефайловых результаты, например, псевдонимы. (Альтернативно следует, псевдонимы и сил на пути поиска.)

+946
Dianad482 16 нояб. 2021 г., 15:00:55
Другие ответы

Связанные вопросы


Похожие вопросы

Я видел доклады для Fitbit ч на 25 ударов в минуту. Я не знакома с доктором испытательного импульса Кока, но в статье вы даете ссылку на упоминает частоты импульсов, которые отличаются всего на 10 ударов в минуту. Похоже, что потребитель фотоплетизмограммы мониторы работают лучше, когда пациент не активен. Я подозреваю, что точность также зависит от вашей физиологии. Я рекомендовал бы пробовать наручные монитор, таких как Fitbit час, нагрудный ремень монитор, и взяв свой пульс вручную. Сделать это, пока ты не активен и сравнить результаты. Если для Fitbit HR является от вашего ручного измерения на 25 ударов в минуту, похоже, это не будет полезно для доктор испытательного импульса Кока.

Есть и другие варианты для мониторинга сердечного ритма, которые являются очень точными:

  1. Холтеровский монитор. Они, как правило, установлены приборы--больницы или врача кредиты их вам (хотя кажется, что вы можете получить их на eBay).
  2. Имплантируемого кардиомонитора (ИКМ) (также известный как имплантируемый петлевой регистратор (ПТО)). Это имплантируемое устройство, похожее на кардиостимулятор, однако он только измеряет ваш сердечный активность-это не дает терапия (электростимуляция). Некоторые примеры Биотроник биомониторинга и Медтроник раскрыть технологии LINQ.
  3. Есть одноразовые Холтера монитор патчи, которые выходят на рынок. Многие из них до сих пор в клинических испытаниях. Преимуществом этих устройств является то, что они не должны быть имплантированы и вам не придется носить с собой громоздкий блок на поясе.

Все три указанные выше параметры используются для диагностики заболеваний сердца, глядя на сигналы ЭКГ--они, наверное, перебор для вашего приложения, но они будут работать.

+938
user6664615 16 мая 2010 г., 09:16:56

У меня нет телефона. Его мой старый телефон, но я все-таки зашел на мою почту. Как я могу отключить его от моего реального телефона? У меня нет старого телефона на меня.

+783
Patrick Tatoosh 26 авг. 2017 г., 21:21:43

Как прокомментировала Патрисия Шанахан и подтвердил мне Мексика консульство, проездные документы очень паспортных документов, таких как

...выданные органами государственного управления для граждан других стран, что они имеют специальную иммиграционную ситуацию и они не могут получить документ для своей страны...

В основном паспорта для людей, которые в силу особой ситуации, не могут получить паспорта из своей страны.

Расширенный драйвер лицензии, сентри пройти, Нексус карты, свидетельства о рождении это не считается проездных документов, и не может быть использована для въезда в Мексику.

США паспорт карта может быть использована гражданам США для въезда в Мексику по суше (пересечение границы из США в Мексику), в противном случае паспорт (или проездной документ) является обязательным для всех мексиканских граждан для въезда в Мексику.

+768
Vincent Alli 27 июл. 2017 г., 15:04:20

У меня есть файл fasta как:

грэп -а 7-Б 4 COSN229024 неправильно.Фаста:

>COSN9627597
CGCTGGGCTCGCCTCCAGCCTGGCCTGCATTCCCAAATCTA
>COSN8175610
CAAGAGAGAAATTCTGACACCTCCTAAGTCTACCAAGCTTT
>COSN229024
CACTATAAAAATATTAAGAGA
>COSN18183003
TGTGTTTGTGATTGATGT
>COSN18487588
TGCTTACCCCTTAAATGCAACTTATTTACTTTTACCACTGT
>COSN1681903|COSN1178783
CTTCCCAACTCATGAGTTCTGAATTCCAATACGTCTCCATT

Я заметил, что в этом плохого.Фаста примерно половина последовательности >COSN229024 распадается и образует новую последовательность >COSN18183003. В конце концов, весь порядок заголовок Фаста испортить после расставания. Итак, я хочу поставить перерыва часть >COSN229024 обратно в >COSN229024 в неверной.fasta и чем перенести / заменить заголовок. Я использовал грэп -а 7-Б 4 COSN229024 неправильно.Фаста. Мой желаемый результат будет выглядеть так :

>COSN9627597
CGCTGGGCTCGCCTCCAGCCTGGCCTGCATTCCCAAATCTA
>COSN8175610
CAAGAGAGAAATTCTGACACCTCCTAAGTCTACCAAGCTTT
>COSN229024
CACTATAAAAATATTAAGAGATGTGTTTGTGATTGATGT
>COSN18183003
TGCTTACCCCTTAAATGCAACTTATTTACTTTTACCACTGT
>COSN18487588
CTTCCCAACTCATGAGTTCTGAATTCCAATACGTCTCCATT
>COSN1681903|COSN1178783
........так далее, и так далее
+736
tafik 26 нояб. 2017 г., 08:41:18

Несколько дней назад я написал о том, как мой MacBook Pro не глюк, где все, кроме громкости, яркости и движения мыши перестали работать.

Теперь у меня похожие, но очень отчетливый проблема на том же устройстве. Так вот, вся клавиатура работает, но команду cmdвкладку Ярлык для переключения приложений, УМКпространство ярлык для поиска, и капс лок клавиши не работают (капс лок не работал в других глюках).

Странно, я могу типа КМДТ чтобы открыть новую вкладку в Chrome, так что ключ должен работать. В отличие от другой глюк, я могу использовать вкладку ключ, а также.

Любой идеи, как я могу устранить это?

+694
Niall Gray 24 мая 2023 г., 11:42:03

Я использую свой мини-для домашнего кинотеатра, но ИК не активный экран.
Используя совместный доступ к экрану будет активировать экран.
Я вижу, как другие сообщили, это проблема с 10.8.2, что ушел с 10.8.3. Увы 10.8.3 не вылечить эту проблему для меня.


Изначально я подозревал, что это из-за сна/гибернации, но это будет ложь, как я могу по SSH к мини и использовать его хорошо. Также я побежал Плекс домашний театр приложения под "caffeinate", и это не помогло.

Предварительное исследование: я прочитал много страниц, форумов, статей (см. Ссылки внизу). Пробовал много комбинаций настроек, но безрезультатно. Я обращаюсь к клиент StackExchange для руководства.

  • Мой предыдущий мини работает Снежный Барс работал просто отлично, но я не хочу установить Snow Leopard на мой покойный модель мини.
  • Я пробовал NVROM/выпускного сброс 4 раза. Не помогло.

Моя машина:

Мак мини - в конце 2012 - программное обеспечение ОС Х 10.8.3 (12D78)

Ссылки Сайтов:
Мак мини не проснется после сна с пумой

+643
Tapos Mondol 1 июл. 2010 г., 22:37:51

Будда дал подробный ответ на обработку страх и трепет в Сутта СН 11.3. Ниже я процитирую главное:

“А вот, монахи, я говорю это: если вы отправились в лес или подножья дерева или в пустую хижину, и страх или трепет или ужас должна возникнуть в вас, то в этом случае вы должны вспомнить меня таким образом: ‘Благословенный-арахант, полностью просветленный, совершенный в истинном знании и поведении, достигший блага, знаток мира, непревзойденный вожак тех, кто должен обуздать себя, учитель богов и людей, просветленный, благословенный.’ Когда вы вспомните мне, монахи, какой бы страх или трепет или ужас, вам, возможно, будет быть брошенной.

“Если вы не можете вспомнить меня, то вы должны вспомнить Дхаммы таким образом: ‘Дхамма превосходно разъяснена благословенным, напрямую видно, немедленно, приглашает пойти и увидеть, применимый, чтобы быть познаваемая мудрыми’. Когда вы вспомните Дхамма, монахи, какой бы страх или трепет или ужас вы можете иметь будут заброшены.

“Если вы не можете вспомнить Дхамму, то вы должны вспомнить Таким образом, Сангха: ‘Сангха учеников благословенного практикует хороший способ, практикуют прямой путь, практиковать истинный путь, практикующие надлежащим образом, то есть четыре пары лиц, восемь типов личностей—это Сангха учеников благословенного достоин даров, достоин гостеприимства, достоин подношений, достоин в почтительном приветствии, непревзойденное поле заслуг для мир. Когда вы вспоминаете о Сангхе, монахи, какой бы страх ни трепета или ужаса, вы, возможно, будете покинуты.

Чтобы ответить на вопрос, почему Будда справиться со страхом? Я бы сказал, что он напомнил Дхаммы. Если кто-то напоминает о Дхамме, весь страх исчезнет или исчезнет.

+643
nak 30 янв. 2014 г., 10:12:27

Существует множество толкований этой заповеди. Есть смысл попытаться понять дух установлений, а потом письмо только. Заповеди-это не произвольная воля Будды.

У них есть функция. Они защищают нас от плохой кармы.

Дело в том, чтобы не попасть в состоянии опьянения. Интоксикация приводит к беспечности. Когда мы в состоянии опьянения, мы не в состоянии ясно мыслить и наши моральные суждения затруднено.

Какой вред от хлебнув немного игристого вина, когда празднуем? Я не вижу никакого вреда, если он не приводит к интоксикации.

Тем не менее, я избегаю даже, что праздничный глоток. Причина в том, что я знаю себя и я заметил, что если я выпью, даже немного, она создает во мне желание хотеть пить больше. Я не знаю, почему я так.

Поэтому я вовсе его избежать. Но я признаю, что есть другой, более дисциплинированные люди, в которых желание напиться не возникает. Для тех людей, я бы сказал, Не нужно зацикливаться на таком принципе. Когда я задумываюсь над этим, я думаю, что заповеди были сделаны именно для слабых людей вроде меня, которые не в состоянии контролировать себя и быть дисциплинированным. Я считаю, что для таких людей, лучше следовать заветам á Ла письмо. Не потому, что они заповеди, но потому что я вижу, они защищают мне с материнской добротой, защищая меня от самой себя, от своей слепой страсти.

+637
mahradbt 27 окт. 2013 г., 11:23:00

Я пытаюсь установить Ubuntu впервые.

Версия = Скобяными 11.04 = Асер TravelMate 4050

Я могу загрузиться с USB или CD-и он загружает нормально.

Я установил и переустановил несколько раз от USB и CD, и это правильно завершается.

Однако, когда я загрузку с жесткого диска, я получаю выше сообщение об ошибке Я не вижу никакой ошибки, как "паника ядра", упомянутых в другом месте.

Это происходит ли я загрузиться с адаптером переменного тока или же с адаптером, но аккумулятор.

Не знаете, как получить дополнительную информацию, чтобы помочь с диагнозом Предложения?

+634
Ricardo Fontenele 24 сент. 2013 г., 11:37:00

Короткий ответ - нет.

На данный момент, большинство аппаратных iPhone 4 и не поддерживает версии. Дело в том, что iPhone 4 анлок не был взломан для того, чтобы установить пользовательский загрузчик который будет загружаться на планшет и, как я говорил раньше, многие из iPhone 4 и оборудования нет драйверов.

Кроме того, iDroid позволяет установить только 2.х на данный момент. Однако, я попросил некоторое время назад разработчики, они сказали мне, что они работают над портированием Андроид 4 для iPhone 4.

В любом случае, пока есть необходимые утилиты для взлома (что также приводит к джейлбрейка, хакер pod2g/хронический может выпустит его в ближайшее время) и достаточно драйверов вы не сможете установить Android на вашем телефоне.

+582
Kumudhavalli 18 апр. 2020 г., 13:04:37

как я могу изменить команду inotifywait в отчет только тогда, когда файл создается определенный тип/расширение

Обратите внимание, что это непроверенного кода , так как я не имею доступ к его прямо сейчас. Но что-то вроде этого должно работать:

inotifywait -м /путь -создать е-е moved_to |
 в то время как чтение файла путь действия; делать
 если [[ "$файл" =~ .*в XML$ ]]; затем # ли конечный файл .в XML?
 Эхо "XML-файл" # если да, то делай свое дело здесь!
интернет
сделано
+550
ntimeu 29 июн. 2019 г., 23:55:02

Все более доминирующей стороной, чем другой, и через несколько лет хорошей жизни большинство людей подбирают случайных травм. Мое левое бедро приводящая, например, имеет какие-то повреждения в нем, поэтому я никогда не можете сделать столько, на левом боку, как и мое право. Хуже, я правша, так что я в конечном итоге с помощью моей правой стороны еще на почти все.

Мышечный дисбаланс может быть проблема, и хотя "сходи к врачу" может применяться слишком широко, вы должны иметь твердое понимание того, что вид использования и мобильности вы можете ожидать от вашей левой стороне. Хороший физический терапевт будет в состоянии дать вам очень целенаправленные упражнения, которые позволят укрепить окружающие мышцы, не вызывая каких-либо новых проблем.

Есть несколько инвалидов-ампутантов и спортсменов, которые существуют в феноменальной форме, и это было, главным образом, через физическую терапию задавая направление и сами инвалид делает много работы.

Короче, мышечного дисбаланса являются общими и универсальными. Но когда они границу или переходить в управление по инвалидности, вам нужен план, который действительно работает для вас подставил кто-то, кто понимает вашу ситуацию.

+459
bla 10 апр. 2015 г., 00:22:44

Больше, чем если бы там был один пользователь, но менее чем вдвое. Это очень трудно быть более конкретным, потому что это во многом зависит от применения.

При переключении на другого пользователя, большинство приложений простоя пользователей не будет ничего делать. Если система требует больше памяти для активных приложений, неиспользуемого приложения будет выгружен. Это означает, скорее всего, приложения ожидания пользователей, но Linux-это очень хорошо решить, что поменять, а то, что есть разные пользователи не будут вводить в рассмотрение.

+373
Nicky Wilks 18 июн. 2017 г., 01:09:44

Разрешение на создание конкретного каталога не привязан к учетной записи пользователя как плотно, как вам кажется. То есть, это не часть счета запись в файле/etc/passwd и.

Пользователь может создать (или удалить) папку в другой каталог, если каталог доступен для записи пользователем или группой, к которым принадлежит пользователь. Это также позволит пользователю создавать/удалять файлы в этом каталоге.

Пример:

$ Общ -ЛД .
директорию типа drwxr-XR-х 2 сам персонал 512 4 мая 16:29 .

Вот только пользователь сам может создавать и удалять файлы и каталоги, каждый способен открыть каталог и список содержимого каталога (в Х а р и разрешения).

$ Общ -ЛД .
drwxrwxr-X 2 двух-сам персонал 512 4 16:29 мая .

В этом случае сам пользователь, а также все пользователи, входящие в группу сотрудники могут создавать и удалять файлы и Директории в текущей директории.

+291
Ratih Puja W 20 февр. 2023 г., 07:32:17

На терминале введите команду shutdown-r от 10 ждали 10 минут до рестарта& , которые сделают сервер перезагрузится через 10 минут, передал в эфир сообщение о том, что и при нажатии Ctrl+C будет прервать перезагрузку запросу.

На терминале введите команду shutdown-r в 18:00 Перезагрузка в 18:00 часов , что сделает перезагрузки в 18:00 часов, будет транслировать сообщение, объясняя, что и может быть прервана с помощью Control+гр.

Вы можете также прервать любое выключение / перезагрузка запросу на ваш "рабочий" терминал С работе.

+231
Stephen Caldwell 23 июл. 2016 г., 09:06:07

Мы сами оленина (4 - 5 оленей в год) в зависимости от погоды. Если холодно и мы можем повесить мясом, потом мы сами. Если это слишком тепло, то мы берем оленя к процессору минус тримминги. ОК - я вытачиваю оленины, используя старый кухонный центр Остера. Когда я оттепели пакет 1 фунт, то я могу добавить сырой свиной колбасы, тертый сыр, лук смешать бульон, вустерский соус, или соевый соус в любой комбинации. Я делаю 1/3 фунта гамбургеров с 3/4" отверстие в центре. Бургеры будут готовить равномерно и быстро. Я использую тот же метод дырявых для котлеты из говядины тоже. Нет руды сырьевых центров и готовят на улице.СС.

+224
juanlugm 23 авг. 2017 г., 03:11:36

Я смотрел на мое растение брокколи сегодня, потому что это было около 60 градусов, и заметил, что стебель брокколи крутишься туда-сюда. Что бы вызвать это?

Я делаю заряженные ядра садоводства, и Идем мочить трубой по некоторым данным больше воды в различных областях, чтобы способствовать росту в этих областях.

Я знаю, что это морковка, но представьте себе один из этих моркови будучи стебель брокколи прямо над землей.

enter image description here

+104
Rough Dude 23 дек. 2015 г., 05:57:37

Вариант 1# с помощью цикла for

для размещения в $(< inputfile.txt );
делать 

 СШ $рать команду shutdown-r теперь 

сделано

Вариант 2# Использование команды xargs

команды xargs -N1 и -я{} Эхо СШ {} команду shutdown-r теперь < inputfile.txt

Примечание: необходимо СШ логин пароль меньше или он будет просить пароль для каждого узла, который указан в входной_файл

+97
Austen Osborne 13 авг. 2020 г., 17:07:41

В прошлом году я ездил на FlyDubai в Стамбул из Пакистана через Дубай. Рейс в Дубай был 1 час. Мне пришлось бежать по аэропорту, чтобы успеть на мой рейс, и я был последним человеком на борту самолета. Во-вторых, когда я приехала в Стамбул, я должен знать, что авиакомпания не передать моя камера. На все это проверено, они сообщили, что камера находится в Дубае, и он прибудет на следующий день.

Сколько стоит безопасная остановка времени, достаточный как для пассажиров и багажа должны быть переведены на следующий рейс?

+49
ThePerfinator 2 апр. 2019 г., 13:57:48

Каскадные таблицы стилей (CSS) - это язык таблиц стилей, используемый для описания представления семантики (внешний вид и форматирование) документа, написанного языком разметки. Наиболее распространенное применение-это стиль веб-страниц, написанных на HTML и XHTML, но язык может также применяться к любым XML-документа, включая plain XML, в формате SVG и XUL.

+20
Mariyanto Mastok 15 янв. 2016 г., 07:54:57

Показать вопросы с тегом